DNA Code Bracelets

DNA CODE BRACELETS

 

Materials needed and instructions are below. You can also download a PDF of this activity.

MATERIALS YOU'LL NEED:

•    Beads in four different colors
•    Four plates or containers to separate the beads by color
•    Two pieces of string, approx. 12 inches long
•    Thread 
•    Scissors 
•    Section of DNA code (per the American Museum of Natural History) - see below:


DNA CODE:

SUNFLOWER (Helianthus annuus)  - tgagatgttagaaggtgcaaaatcaataggggccggagctgctacaattg

GRIZZLY BEAR (Ursus arctos) - atgaccaacatccgaaaaacccacccattagctaaaatcatcaacaactc

CHIMPANZEE (Pan troglodytes) tgaccccgacacgcaaaattaacccactaataaaattaattaatcactca

AFRICAN ELEPHANT (Loxodonta africana) - atgaccgacattcgaaaatctcatccttcactcaaaatgatgaataa

MONARCH BUTTERFLY (Danaus plexippus) -  gaggctaccaagtttccgatctgtaggagatgcattgaaagatcgtt

APPLE TREE  (Malus domestica)  - gaattcggcacgagaagaaacgaagagagagagagagagcaaaaatggtt

BROWN TROUT (Salmo trutta) - ctttggctcactcttaggcttgtgtctagccacccaaattcttaccggac

HUMAN (Homo sapiens) - tgaccccaatacgcaaaattaaccccctaataaaattaattaaccgctca


INSTRUCTIONS
Follow the steps below (and follow along with our YouTube video) to make your own DNA code bracelet.

1.    Assign each bead color a DNA base letter. In the video, Eleanor assigned her blue beads as Adenine (A), her orange beads as Cytosine (C), her pink beads as Thymine (T), and her purple beads as Guanine (G).

2.    Separate your beads into different plates or containers, sorted by color.

3.    Place a label in each container so you remember which base/bead combo is which.

4.    Tie a couple of knots about two inches from one end of each of your two strings.

5.    Choose a section of DNA (options listed above). This is the pattern that you’ll follow as you string the beads onto your bracelet. Eleanor chose the sunflower’s DNA.

6.    As you add beads, they will match up in the same way the bases in DNA do: A always goes with T, and C always goes with G. Every time you put a bead on one string, you must add its partner bead to the other string.

7.    Keep threading beads following the pattern, always remembering to pair the two bases that go together.

8.    Tie a knot around the last bead of each string, and then tie the ends of the strings together.

9.    Lastly, twist your two strings together so that the correct beads match up; and then wrap a piece of thread around the two strands in order to keep the in the twisted position.